MO640 - Exercises - Sequence Comparison, Setubal and Meidanis 1997 - chapter 3

Exercises marked with (*) require further reading/search beyond the suggested texts.

  1. Find an optimal local alignment between the following two sequences, with respect to the scoring scheme p(a,b) = 1 if a = b, p(a,b) = -1 if a ≠ b, and g = -2.
    atcgatcagtcagc
    cgatcagcatgcatcgatatccagtcagtcaccgcgatgctcgatcgtacgatcgaccgatcg
  2. Give one possible scoring system equivalent to the edit distance.
  3. BLAST the following amino acid sequence and find out whether it aligns with a continuous stretch of some important protein.
    QQLEDLKGYLEWITQAE

MO640 Home

© 2015 Joao Meidanis