MO640 - Exercises - DNA Evolution Models, Durand-lec-notes (2014), Felsenstein (2004)- chapters 11 and 13

Exercises marked with (*) require further reading/search beyond the suggested texts.

1. Two 41-character long DNA sequences differ in 6 positions. Admitting that their evolution follows the Jukes-Cantor model, what is the Jukes-Cantor distance between them?
2. Two 100-character long DNA sequences differ in 15 positions, with 6 of them being transversions and 9 transitions. Admitting that their evolution follows the Kimura two-parameter model, find the transition and transversion rates multiplied by time.
3. Find the Jukes-Cantor and Kimura distances between the following sequences:

   CTAGGCTTACGATTACGAGGATCCAAATGGCACCAATGCT
CTACGCTTACGACAACGAGGATCCGAATGGCACCATTGCT

MO640 Home

© 2015 Joao Meidanis